【病毒外文文獻(xiàn)】2014 Cell adhesion as a novel approach to determining the cellular binding motif on the severe acute respiratory syndrom

《【病毒外文文獻(xiàn)】2014 Cell adhesion as a novel approach to determining the cellular binding motif on the severe acute respiratory syndrom》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2014 Cell adhesion as a novel approach to determining the cellular binding motif on the severe acute respiratory syndrom（6頁珍藏版）》請在裝配圖網(wǎng)上搜索。

Journal of Virological Methods 201 2014 1 6 Contents lists available at ScienceDirect Journal of Virological Methods j o ur na l ho me pa ge Cell adhesion as a novel approach to determining motif on the severe acute respiratory syndrome protein H22845 Hsin Hou Chang a b Po Kong Chen b Guan Ling Lin b Chun Jen Yu Cheng Hsiao a Jing Hua Dong a Der Shan Sun a b a Department of Molecular Biology and Human Genetics Tzu Chi University Hualien Taiwan b Institute of Medical Sciences Tzu Chi University Hualien Taiwan c The Department of Life Sciences Tzu Chi University Hualien Taiwan Article Received Received Accepted Available Keywords SARS CoV Spike Vero Binding motif pathogens rate investigate safe SARS CoV and candidates 2014 The Authors Published by Elsevier B V All rights reserved 1 Introduction Asia et spread high such and also problems chological spike 2 diphenyltetrazolium mons non commercial original Tzu Chi Tel is required to investigate a therapeutic approach to these diseases 0166 0934 http dx doi org 10 1016 j jviromet 2014 01 022 Severe acute respiratory syndrome SARS first appeared in in 2002 caused by the SARS coronavirus SARS CoV Drosten al 2003 Holmes 2003 Peiris et al 2003 The illness quickly worldwide and affected more than 8000 people with a case fatality rate Kuehn 2013 Newly emerging pathogens as the avian influenza A virus H7N9 Wu and Gao 2013 MERS CoV Middle East Respiratory syndrome coronavirus known as HCoV EMC Kuehn 2013 are severe public health that cause a high case fatality rate and widespread psy effects on society and the economy A simple method Abbreviations SARS CoV severe acute respiratory syndrome coronavirus S RBD receptor binding domain ACE2 angiotensin converting enzyme RBM receptor binding motif MTT 3 4 5 dimethylthiazol 2 yl 2 5 bromide H22845 This is an open access article distributed under the terms of the Creative Com Attribution NonCommercial No Derivative Works License which permits use distribution and reproduction in any medium provided the author and source are credited Corresponding author at Department of Molecular Biology and Human Genetics University No 701 Section 3 Zhong Yang Road Hualien 970 Taiwan 886 3 8565301x2681 fax 886 3 8561422 E mail addresses dssun mail tcu edu tw dershansun D S Sun without contacting the biohazardous virus Previous studies have completed whole genome sequences 29 751 base pairs Marra et al 2003 Ruan et al 2003 The data reveal SARS CoV to be a novel coronavirus that does not belong to any of the 3 known classes of coronavirus Marra et al 2003 The genomes encode 23 putative proteins including known coronavi rus proteins such as replicase 1A replicase 1B spike glycoprotein S small envelope protein membrane glycoprotein and nucleo capsid protein Marra et al 2003 Ruan et al 2003 The S gene nucleotide nt 21 492 25 259 encodes a transmembrane gly coprotein on the viral surface and is responsible for binding and entry into the host cells Marra et al 2003 The S protein can be divided into 2 functional domains S1 and S2 The S1 domain contains a receptor binding domain RBD responsible for specific binding to the host receptor Gallagher and Buchmeier 2001 The angiotensin converting enzyme 2 ACE2 is a functional receptor for SARS CoV Li et al 2003 After binding to ACE2 conformational change of the S protein induces exposure of the S2 domain and assists the virus in fusing to the host cells Matsuyama and Taguchi 2002 Therefore the RBD within the S1 domain is the target for development of virus entry blocking peptides and neutralizing antibodies to prevent SARS CoV infections Previous studies have used various methods to investigate the potential RBD from amino acids spanning 303 537 Xiao et al 2003 270 510 Babcock et al see front matter 2014 The Authors Published by Elsevier B V All rights reserved history 21 August 2013 in revised form 20 January 2014 24 January 2014 online 13 February 2014 protein E6 cells a b s t r a c t Emerging life threatening avian origin influenzas H7N9 caused a high case fatality rapid and safe method to study a simple quick and cellular binding site on the binding site helped to minimize tides spanning the 436 445 inhibitor or peptide vaccine the cellular binding coronavirus spike Wang c Chih Hsien Liao a such as severe acute aspiratory syndrome coronavirus SARS CoV and the Middle East respiratory syndrome coronavirus MERS CoV have and psychological effects on society and the economy Therefore a simple a therapeutic approach against these pathogens is required In this cell adhesion inhibition assay was developed to determine the potential spike protein Various synthetic peptides covering the potential further the binding motif to 10 25 residues Following analyses 2 pep 437 461 amino acids of the spike protein were identified as peptide against SARS CoV 2 H H Chang et al Journal of Virological Methods 201 2014 1 6 2004 318 510 He et al 2004 Wong et al 2004 485 625 Zhou et al 2004 261 672 Sui et al 2004 48 358 Chou et al 2005 and 450 650 Zhao et al 2005 which all span hundreds of residues A receptor binding motif RBM residues 424 494 located within the RBD has been identified based on the crystal structure of the SARS CoV spike protein RBD residues 306 527 with the receptor ACE2 Li et al 2005 However no effective ther apeutic to tein used residues in safe 2 2 1 S1 3 pGEX 6P 1 protein TW1 18 TW1 19 ing and one GGAATTC 3 AAAGGGCCTAAGCTT 3 protein TW1 19 S2 encoding and taining SS R3 3 cloned NJ ligation S1 2 pGEX 6P 1 to technologies 2 2 methods Tseng recombinant 2 pGEX 6P 1 2002 expression proteins studies Sun were 0 5 adding the ture at 2KS pellets of E coli cells from a 1 L culture were resuspended in 50 mL 1 phosphate buffered saline PBS containing protease inhibitors 1 mM phenylmethylsulfonyl fluoride PMSF 0 7 H9262g mL of pepstatin 1 H9262g mL of leupeptin and 2 mg mL of lysozyme The bacterial cells were subsequently disrupted using a French Press The cell lysates were centrifuged at 10 000 g for 30 min and passed through 0 45 H9262m filters to remove insoluble cell com agents against SARS CoV have been developed in humans Jiang et al 2013 In this study a cell adhesion inhibition assay was established characterize further the potential RBM of the SARS CoV S pro Synthetic peptides spanning the potential binding site were and the RBM was further narrowed to approximately 10 25 This method is useful for characterizing the potential RBM the RBD of newly emerged coronaviruses in a quick simple and manner without contacting life threatening pathogens Materials and methods Construction of S1 1 pGEX 6P 3 S1 2 pGEX 6P 1 and expression plasmids Using 2 plasmids encoding the SARS CoV spike S1 nucleotide nt nt 20 704 22 087 and nt 21 826 22 087 as templates an S1 1 encod SARS CoV S protein 1 446 amino acid was produced amplified by polymerase chain reaction PCR using pair of primers SS F1 2 containing the EcoRI site 5 prime CATGTTTATTTTCTTATTATTTCTTACTCTCACTAGTGGTAG prime and SS R4 3 containing the HindIII site 5 prime GCCATGTCTAAGCTACCTATATTTATAATTATAA prime Using 2 plasmids encoding the SARS CoV spike S1 nt 21 826 22 087 the S1 protein and the protein TW1 20 nt 23 077 24 454 as templates the S1 2 SARS CoV S protein 447 641 amino acid was produced amplified by PCR using one pair of primers SS F3 2 con the HindIII site 5 prime GACATGGCAAGCTTAGGCCCTTT 3 prime and containing the SalI site 5 prime GAAGTGTCGACATGCTCAGCTC prime The PCR products of S1 1 and S1 2 were subsequently into pGEX 6P 3 and pGEX 6P 1 Amersham Biosciences USA through EcoRI HindIII and HindIII SalI digestion and respectively The S1 1 fragment was subcloned into through EcoRI HindIII digestion and ligation form S1 3 pGEX 6P 1 using standardized molecular cloning Sambrook et al 1989 Protein expression and purification The Escherichia coli culture was performed based on standard Sambrook et al 1989 Liou et al 2011 Chang et al 2012 et al 2013 The glutathione S transferase GST containing protein expression plasmids S1 1 pGEX 6P 3 S1 S1 3 pGEX 6P 1 and pGEX 2KS Chang et al 1993 were transformed into the E coli strain BL21 DE3 for The induction and purification of the recombinant were performed using methods modified from previous Chang et al 1993 1997b 2000 Chang and Lo 2000 et al 2007 Bacteria containing the expression plasmids grown in a 2 YT broth 1 6 trypton 1 yeast extract and NaCl at 37 C The recombinant proteins were induced by isopropyl H9252 d 1 thiogalactopyranoside IPTG 1 mM to medium after the optical density OD of the bacterial cul reached 1 0 The optimal induction conditions were incubated 37 C for 2 h S1 2 pGEX 6P 1 S1 3 pGEX 6P 1 and pGEX and 4 h S1 1 pGEX 6P 3 For purification the centrifuged ponents The filtered cell lysates were loaded into a glutathione sepharose 4B column and the flow through was again reloaded into the column to ensure saturated binding The proteins were eluted using an elution buffer 10 mM glutathione 50 mM Tris HCl pH 9 6 1 mM PMSF 0 7 H9262g mL of pepstatin and 1 H9262g mL of leupeptin and dialyzed with 1 PBS containing 1 mM PMSF Consequently all recombinant proteins used in this study were GST tagged The protein concentration was determined using a protein assay kit Bio Rad Hercules CA USA 2 3 Antibody generation and purification New Zealand rabbits were purchased from the National Labo ratory Animal Center Taipei Taiwan and maintained in a specific pathogen free condition in the experimental animal center of Tzu Chi University The research methods involving the experimental rabbits were performed under strict adherence to the guidelines of the Institutional Animal Care and Use Committee Tzu Chi Univer sity and the guidance of Animal Protection Law Taiwan Using methods modified from previous studies Harlow and Lane 1988 Chang et al 2002 Sun et al 2007 250 500 H9262g of purified recom binant proteins were mixed with complete Freund s adjuvant and injected into New Zealand rabbits for the first immunization For boosting 100 250 H9262g proteins were mixed with incomplete Fre und s adjuvant and injected in immunization cycles in 3 week intervals After 5 immunizations sera from rabbits were isolated and passed through the Protein A column Immunoglobulin IgG fractions were eluted using an elution buffer 0 1 M citric acid pH 3 0 and dialyzed with 1 PBS 2 4 Synthetic peptides Synthetic peptides GA91 corresponding to SARS CoV Spike protein 437 461 amino acids were produced in linear form Synthetic peptides GA101 corresponding to SARS CoV S protein 436 445 amino acids GA107 corresponding to SARS CoV S pro tein 466 475 amino acids and GA142 corresponding to SARS CoV S protein 100 109 amino acids were produced in branched mul tiple antigenic peptide M8 form All synthetic peptides were provided by Genesis Biotech Taipei Taiwan 2 5 Cell culture and cell adhesion inhibition assay Vero E6 cells ATCC No C1008 and HeLa cells ATCC No CCL 2 2 were maintained in RPMI 1640 BioWest Miami FL USA and NIH3T3 cells ATCC No CRL 1658 were maintained in Dulbecco s modified Eagle s medium DMEM BioWest containing 10 heat inactivated fetal bovine serum Biological Industries Beit Haemek Israel 2 mM l glutamine BioWest 100 U L of penicillin BioW est 100 mg mL of streptomycin BioWest and non essential amino acid BioWest Cell adhesion and inhibition assays were performed according to our previously described methods Chang et al 1993 1997a Chang and Lo 1998 Chang et al 1999 2001 2002 2003 Chang et al 2005 Sun et al 2005 Chang and Lo 2007 Recombinant proteins 1 2 H9262g 30 H9262L cover slip were coated on cover slips at 37 C for 1 h in 6 well microtiter plates and then blocked with 5 bovine serum albumin BSA at 37 C for a further hour After being washed twice with PBS cells 1 10 6 pre mixed with antibodies 75 H9262g or synthetic peptides 10 nmol at 37 C H H Chang et al Journal of Virological Methods 201 2014 1 6 3 Fig 447 641 SARS CoV plates the PCR The to into 437 461 acids SARS CoV S for medium cells temperature cells CFL 3 3 1 protein the have binant Chakraborti fragments structed S binant the cycles 3 2 proteins ney Marra protein coated cell S1 3 than These RBD S1 2 the Fig 2 The SARS CoV S protein fragment S1 3 significantly accelerated the cell adhe sion of Vero E6 cells and this effect can be inhibited by anti S1 1 and anti S1 2 antibodies Recombinant proteins GST S1 2 and S1 3 1 2 H9262g were coated on cover slips in a 6 well dish which was blocked with 5 bovine serum albumin Vero E6 cells were seeded onto recombinant S protein coated cover slips and a binding assay was subsequently performed A a c For the inhibition assay Vero E6 cells were pre mixed with antibodies 75 H9262g and seeded onto S1 3 pre coated cover slips A d f Cell images were captured using an inverted microscope at 100 magnifica tion The adherent cells were counted from 3 randomly selected nonoverlapping fields of each condition The average cell counts of adherent cells in the GST coated 1 Relative locations of SARS CoV spike protein fragments S1 1 1 446 S1 2 and S1 3 1 641 and related peptides Using 3 plasmids encoding the spike S1 and S2 proteins TW1 18 TW1 19 and TW1 20 as tem S1 1 encoding the SARS CoV S protein 1 446 amino acids and S1 2 encoding SARS CoV S protein 446 641 amino acids was produced and amplified using using 2 primers SS F1 2 and SS R4 3 and SS F3 2 and SS R3 respectively PCR products of S1 1 and S1 2 were subcloned into pGEX 6P 3 and pGEX 6P 1 form S1 1 pGEX 6P 3 and S1 2 pGEC 6P 1 The S1 1 fragment was subcloned S1 2 pGEX 6P 1 to form S1 3 pGEX 6P 1 Synthetic peptides GA91 spanning amino acids of the SARS CoV S protein GA101 spanning 436 445 amino of the SARS CoV S protein GA107 spanning 466 475 amino acids of the S protein and GA142 spanning 100 109 amino acids of the SARS CoV protein are shown in the black boxes 30 min were seeded onto pre coated cover slips and grown in at 37 C for 45 min After being washed twice with PBS were fixed with 4 paraformaldehyde in 1 PBS at room for 30 min After being washed with PBS again the were examined using an inverted microscope Axiovert 40 Carl Zeiss Gottingen Germany and photographed Results Construction of expression plasmids for the SARS CoV spike The cell adhesion assay required recombinant proteins of S1 domain and corresponding antibodies Previous studies reported that prokaryotic expressed non glycosylated recom S proteins retained their function Zhou et al 2004 et al 2005 Zhao et al 2005 In this study different of the S1 domain S1 1 S1 2 and S1 3 were con into E coli expression vectors and expressed as glutathione transferase GST fusion proteins Fig 1 S1 1 and S1 2 recom proteins encompassing amino acids 1 446 and 447 641 of S protein were used to immunize rabbits for 5 immunization to obtain corresponding antibodies Determination of potential binding site of SARS CoV spike by using a cell adhesion assay Previous studies have shown that SARS CoV can infect the kid cells of the African green monkey Vero E6 Li et al 2003 et al 2003 Purified GST S1 3 and S1 2 recombinant cover slips and Vero E6 cells were used to perform a adhesion assay The cell adhesion efficiency of Vero E6 cells to coated cover slips were approximately 1 5 to 1 7 fold higher that on GST coated controls Figs 2A a b B 4A a b and B results indicate that E coli derived S1 3 contains functional for Vero E6 cells In contrast the efficiency of cell adhesion on coated substrates is less than that of substrates coated with control protein GST Fig 2A c and B The cell adhesion of Vero groups served as controls and defined as 100 The percentages of adherent cells are shown in B P 0 05 P 0 01 compared with the control groups Data are reported as the mean standard deviation SD E6 on S1 3 coated substrates could be inhibited by rabbit polyclonal antibodies against S1 1 and S1 2 but cannot be inhibited by control antibodies against GST Fig 2A d f and B These results indicated that the RBD potentially locates around the S1 1 and S1 2 junction region 3 3 The permissive cell line Vero E6 but not the non permissive cell lines HeLa and NIH 3T3 adhere to SARS S coated surfaces To verify whether the S protein mediated cell adhesion is specific to SARS CoV permissive cells e g Vero E6 cells 2 SARS CoV nonpermissive cell lines HeLa and NIH3T3 which cannot be infected by SARS CoV Wang et al 2004 were used as controls to perform the cell adhesion assay The cell adhesion effi ciency of NIH3T3 or HeLa cells to GST and S1 3 coated substrates did not show significant differences Fig 3 This suggests that 4 H H Chang et al Journal of Virological Methods 201 2014 1 6 Fig adhesion with A b panel coated an from cell centages C S1 3 mediated SARS CoV 3 4 in corresponding perform that GA101 Vero 466 475 did encompassing S1 1 ing 4 to Most fragments etry Wong assay between immunosorbent Ho study might not provide high quantitative and sensitive data that matches the flow cytometry Babcock et al 2004 He et al 2004 Sui et al 2004 Wong et al 2004 Zhou et al 2004 and ELISA based analyses Xiao et al 2003 He et al 2004 Ho et al 2006 the analysis only requires recombinant proteins peptides virus permissive cells and an ordinary light microscope to accomplish Consequently expensive equipment such as the flow cytome 3 SARS nonpermissive cell lines NIH3T3 and HeLa have no preferential cell to the GST tagged SARS CoV S protein fragment S1 3 when compared the GST control protein Recombinant proteins GST A a and A c and S1 3 and A d 1 2 H9262g were coated on cover slips in 6 well dishes NIH3T3 A left and HeLa cells A right panel were seeded onto recombinant protein pre cover slips and performed binding assay Cell images were captured using inverted microscope at 100 magnification The adherent cells were counted 3 randomly selected nonoverlapping fields of each condition The average counts of adherent cells in the GST coated groups served as controls The per of adherent cells of the NHI3T3 and HeLa cells groups are shown in B and respectively Data are reported as the mean SD cell adhesion can be specifically applied on permissive cells The minimum binding site can be determined using peptides the inhibition assay for cell adhesion To narrow down the RBD of S protein several synthetic peptides to the S1 1 and S1 2 junction region were used to the inhibition assay for cell adhesion Our data revealed synthetic peptides GA91 spanning residues 437 461 and spanning residues 436 445 inhibit the cell adhesion of E6 cells on S1 3 coated substrates GA107 spanning residues exerted a smaller inhibitory effect than GA91 and GA101 in the cell binding assay GA42 spanning residues 100 109 amino acid residues outside the junction between and S1 2 exerted only minor inhibition effects in the cell bind assay Fig 4 Discussion In this study a simple quick and safe method was established narrow down the RBM within the RBD of SARS CoV S protein popular methods investigating the RBD of SARS CoV S identify of SARS S protein binding to cells by using flow cytom analysis Babcock et al 2004 He et al 2004 Sui et al 2004 et al 2004 Zhou et al 2004 and an immunofluorescence Chou et al 2005 Ho et al 2006 or determine the binding ACE2 protein and S protein by using an enzyme linked assay ELISA Xiao et al 2003 He et al 2004 et al 2006 Although the cell adhesion assay developed in this ter fluorescence microscope and ELISA fluorescence microplate readers are unnecessary and this assay can be easily conducted in general laboratories including those in third world countries Because cell adhesion can be easily measured using MTT 3 4 5 dimethylthiazol 2 yl 2 5 diphenyltetrazolium bromide a yellow tetrazole assays this method has the potential of being developed as a high throughput screening system for small molecule inhibitors when combined with automatic and robotic systems which are unsuitable for flow cytometry and the immunofluorescence micro scope based assay ELISA is also available for high throughput or fast screening systems however the reco